Ascaris suum

The nucleotide sequences of the mitochondrial DNA (mtDNA) molecules of two nematodes, Caenorhabditis elegans [13,794 nucleotide pairs (ntp)], and Ascaris suum (14,284 ntp) are presented and compared. Each molecule contains the genes for two ribosomal RNAs (+rRNA and 1-rRNA), 22 transfer RNAs (tRNAs) and 12 proteins, all of which are transcribed in the same direction. The protein genes are the same as 12 of the 13 protein genes found in other metazoan mtDNAs: Cyt b, cytochrome 6; COI-111, cytochrome c oxidase subunits 1-111; ATPase6, F, ATPase subunit 6; ND16 and 4L, NADH dehydrogenase subunits 1-6 and 4L: a gene for ATPase subunit 8, common to other metazoan mtDNAs, has not been identified in nematode mtDNAs. The C. elegans and A. suum mtDNA molecules both include an apparently noncoding sequence that contains runs of AT dinucleotides, and direct and inverted repeats (the AT region: 466 and 886 ntp, respectively). A second, apparently noncoding sequence in the C. elegans and A. suum mtDNA molecules (109 and 117 ntp, respectively) includes a single, hairpin-forming structure. There are only 38 and 89 other intergenic nucleotides in the C. elegans and A. suum mtDNAs, and no introns. Gene arrangements are identical in the C. elegans and A. suum mtDNA molecules except that the AT regions have different relative locations. However, the arrangement of genes in the two nematode mtDNAs differs extensively from gene arrangements in all other sequenced metazoan mtDNAs. Unusual features regarding nematode mitochondrial tRNA genes and mitochondrial protein gene initiation codons, previously described by us, are reviewed. In the C. elegans and A. suum mt-genetic codes, AGA and AGG specify serine, TGA specifies tryptophan and ATA specifies methionine. From considerations of amino acid and nucleotide sequence similarities it appears likely that the C. elegans and A. suum ancestral lines diverged close to the time of divergence of the cow and human ancestral lines, about 80 million years ago. T HE mitochondrial (mt-) genomes of multicellular animals (metazoa) are contained in a single, circular molecule with a species-specific size that varies from 14 to 39 kb (MORITZ, DOWLING and BROWN 1987; SNYDER et al. 1987). The only known exceptions are found in the cnidarian genus Hydra where the mt-genomes occur as two unique 8-kb linear molecules (WARRIOR and GALL 1985). Complete nucleotide sequences and gene content have been determined for four mammals; human, cow, mouse, and rat (ANDERSON et al. 1981, 1982a,b; BIBB et al. 1981; GADALETA et al. 1989); a bird, Gallus domesticus (DESJARDINS and MORAIS 1990); an amphibian, Xenopus lamis (ROE et al. 1985); two sea urchins, Strongylocentrotus purpuratus, and Paracentrotus lividus (JACOBS et al. 1988; CANTATORE et al. 1989); and an insect, Drosophila y kuba (CLARY and WOISTENHOLME 1985a). Also, partial mtDNA sequences have been obtained from a number of other vertebrates and invertebrates (references in GAREY and WOLSTENHOLME 1989). fornia, San Francisco, San Francisco, California 94143. Genetics 1 3 0 471-498 (March, 1992) ’ Current address: Howard Hughes Medical Institute, University of CaliEach completely sequenced metazoan mtDNA contains the genes for the structural RNAs of the mitochondrion’s own protein synthesizing machinery (2 rRNAs and 22 tRNAs), and 12 or 13 proteins. These proteins are all components of the oxidative phosphorylation system: cytochrome b (Cyt b ) , subunits 1I11 of cytochrome c oxidase (COI-III), subunits 6 and 8, of the Fo ATPase complex (ATPase6 and ATPase8), and subunits 1-6 and 4L of the respiratory chain NADH dehydrogenase (ND1-6 and 4L) (CHOMYN and ATTARDI 1987). In each metazoan mtDNA molecule there is a region of variable length 11 25 nucleotide pairs (ntp) to about 20 kb; JACOBS et al. 1988; BOYCE, ZWICK and AQUADRO 19891 that lacks genes, and in some cases has been shown to contain signals for the initiation of replication and transcription (the control region; MONTOYA et al. 1982; CLAYTON 1982, 1984). In some mtDNA molecules segments of various sizes, often within the control region, are duplicated (references in OKIMOTO et al. 199 1). The genetic codes used by metazoan mt-protein genes contain various modifications (BARRELL, BANKIER and DROUIN 1979; BARRELL et al. 1980). In all 472 R. Okimoto et al. metazoan mtDNAs, TGA specifies tryptophan rather than being a stop codon. ATA has been interpreted as specifying methionine rather than isoleucine in all metazoan mt-genetic codes except those of echinoderms (JACOBS et ai. 1988; CANTATORE et al. 1989). In vertebrate mt-protein genes, AGA and AGG are absent (BIBB et al. 1981) or are used as rare stop codons (ANDERSON et al. 1981, 1982b; ROE et al. 1985). However, in D. yakuba mtDNA, AGA (but not AGG) specifies serine and, in nematode, platyhelminth, and echinoderm mtDNAs both AGA and AGG specify serine (WOLSTENHOLME and CLARY 1985; WOLSTENHOLME et al. 1987; HIMENO et al. 1987; GAREY and WOLSTENHOLME 1989). Both translation initiation and translation termination of metazoan mt-protein genes have unusual features [see OKIMOTO, MACFARLANE and WOLSTENHOLME (1 990) for references]. Among many of these protein genes, triplets other than ATG (AUG) are used as translation initiation codons. These include ATA, ATT, ATC, GTG, GTT and TTG. Also ATAA has been suggested as the translation initiation codon of the Drosophila COI gene. Some mt-protein genes in organisms from different metazoan phyla end in T or T A rather than a complete termination codon. UAA codons in mature transcripts of these genes are generated by precise cleavage from multicistronic primary transcripts, followed by polyadenylation (OJALA, MONTOYA and ATTARDI 1981). Because of unusual wobble rules the 22 tRNAs that are encoded in all metazoan mtDNAs are apparently sufficient to decode all of the mtDNA-encoded protein genes (BARRELL et al. 1980). Modifications in structure are found among metazoan mt-tRNA genes. Variation in both size and sequence of the dihydrouridine (DHU) and T q C loops are found in many mttRNA genes in organisms ranging from platyhelminths to mammals (discussion and reference in WOLSTENHOLME et al. 1987; GAREY and WOLSTENHOLME 1989). In all metazoan mtDNAs so far examined the tRNA"'(AGY/A/G) gene lacks a DHU arm (references in GAREY and WOLSTENHOLME 1989). T h e mttRNA"'(UCN) gene of nematodes, but not other metazoa, has a similar structure, and the remaining 20 mt-tRNA genes of nematodes all lack a T 9 C a r m (WOLSTENHOLME et al. 1987, 1989; OKIMOTO and WOLSTENHOLME 1990; OKIMOTO et al. 199 1). In this paper we present and compare the nucleotide sequences of the free-living nematode Caenorhabditis elegans and the pig intestinal parasitic nematode Ascaris suum. Various aspects of these sequences regarding protein, tRNA, and rRNA gene structure, modifications of the nematode mt-genetic code, codon usage, and some evolutionary considerations are discussed. MATERIALS AND METHODS Animals, and mtDNA isolation: Adult A. mum were obtained from pig intestines at a local slaughterhouse. Mitochondria were isolated from body wall muscle or from mature eggs by methods previously used to isolate Drosophila mitochondria (WOISTENHOLME and FAURON 1976). C. elegans (Bristol, N2 strain) were maintained, amplified and harvested as given in BRENNER (1974) and SULSTON and BRENNER (1 974), except that Klebsiella aerogenes was used as the food source. Worms were ruptured with a Dounce homogenizer (pestle A) and mitochondria were isolated as for A. mum, except that mannitol was used instead of sucrose, and all solutions contained 0.1-0.2% bovine serum albumin. Mitochondria from both species were lysed with 10% Sarkosyl and mtDNAs were isolated by cesium chloride-ethidium bromide centrifugation (WOLSTENHOLME and FAURON 1976). Restriction enzyme digestions and cloning: A. mum and C. elegans mtDNA restriction fragments were cloned into the plasmids pBR325 or pUC9 and amplified using as hosts E. coli K12 HBlOl and JMl0l , respectively. Preparation and identification of primary clones, restriction enzyme digestions, electrophoresis, cloning of fragments into bacteriophage M 13 vectors (M 13 mp8, M 13 mp9, M 13 mpl8 and M 13 mplg), purification of single-stranded and doublestranded M 13 DNAs, and preparation of viral DNAs containing partial deletions of cloned restriction fragments of mtDNAs were as given or referred to in CLARY et al. (1 982) and WAHLEITHNER and WOLSTENHOLME (1987). Sequencing and sequence analyses: DNA sequences were obtained by the extension-dideoxy-termination procedure (SANGER, NICKLEN and COULSON 1977) from sets of deletion clones (HONG 1982; DALE, MCCLURE and HOUCHINS 1985) containing overlapping segments of the entire sequence of each complementary strand of the A. suum and C. elegans mtDNA molecules. Consensus sequences were assembled from individual sequences using the compiling program of STADEN (1982). Nucleotide sequences were analyzed by the SEQ program (BRUTLAG et al. 1982). Nematode mt-protein genes were identified by comparing predicted amino acid sequences with amino acid sequences of mouse and D. yakuba mt-protein genes (BIBB et al. 198 1 ; CLARY and WOLSTENHOLME 1985a) using the TYPIN and SEARCH programs (JuE, WOODBURY and DOOLITTLE 1980; DOOLITTLE 1981) and, in some cases, by hydropathic profile comparisons (KYTE and DOOLITTLE 1982). mt-rRNA genes were identified from sequence similarities to mouse and D. yakuba mtrRNA genes, and mt-tRNA genes were identified by eye, from their ability to fold into specific, consensus secondary structures. The nucleotide sequences of the C. elegans and A. suum mtDNA molecules have been submitted to the EMBL Data Library under the accession numbers X54252 and X52453. RESULTS AND DISCUSSION Genome structure and organization: The entire nucleotide sequences of the mtDNA molecules of C. elegans (1 3,794 ntp) and A. suum (14,284 ntp) are given and compared in Figure 1 ; gene content and organization in the two molecules are summarized in the maps shown in Figure 2. These are the smallest metazoan mtDNA molecules so far recorded. Each of the two nematode mtDNAs contains the genes for 12 proteins, 2 rRNAs and 22 tRNAs. The protein genes Nematode Mitochondrial Genomes 473 a Transcription. a l l genes /--tRNA(prof-------------------~ ~ \ /--tRNA(val)------------------~ >-----C . e CAGTAAATAGTTTAAT--AAAAATATAGCATTTGGGTTGCTAAGATATTATTACTGATAGAATTTTTAGTTTAATTTAGAATGTATCACTTACAATGATG 98 I I I I I I I I I I I I I I I I I I I l l I I I I I I I I I I I I I I l l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I O I I I I A . 9 CAGTAGGTAGTTTATTTTTAATGTAGTATTTGGGTTACTGTGA-ATTTTTACTGA--AAACTTTTAGTTTAATTTTAGAATTTCTCGCTTACAATGAGA 97 \--tRNA(pro)--------------------< ~ / \--tRNA(val)------------------~ +-----ND6 """""""C . e GGGTT--TAAAATTCTATAGTAAAAGTGTTTTTTGmTAGCTGTTTTAAGTAGGATTATTAGATATATTAATATTGACCCTATAAAAAGAAGTTTTTTT 196 A . 9 GGGTTTATTAAGTTTTTTGTTGGGTAGTTTCTmTTTTGGCATAAGCTATAT~AATGTGGACCCTATGAAGAGAGTAGCTTTTTT 197 \ M V K V F F V L A V L S S I I S Y I N I D P M K S S F F I I I I I I I I I I I I I I I I l l I I I I I l l I1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I __""""""_ / L L G S F F F L A I I S C V M S Y I N V D P M K S S F F ND6 L I F S L L F S M P V I S M S M H I W F S Y F I C L L F L S G I F C . e CTTATCTTTTCACTACmTTAGTATACCAGTTATTTCAATGAGAATACATATTTGGTTTTCTTACTTTATTTGTTTATTATTTTTAAGTGGTATTTTTG 296 A . 9 TTAATTTTTTCmGTTGATGGTTATGCCTTTGATTTCTTTTTTTTTGCATGTATGGTTTTCTTACTTTATTTGTTTGTTATTTCTAAGTGGGATTTTTG 297 L I F S L L M V M P L I S F F L H V W F S Y F I C L L F L S G I F I I I I I I I I I I I I l l I I I I I I I I I I I l l I I I1 l1111l1111111I I I I I l I I I I I I I I I I I I I I I I I I I I I V I L V Y F S S L S K I N V V K S Y M A V F L L L L S M L Y F S P T C . e TTATTTn;GTATATTTTTCTAGTTTATCTAAAATTAATGTAGTGAA~GTTTATATAGCTGTGTTTTTACTTTTGTTAAGAATGTTATATTTTTCTCCCAC 396 A . 9 TTATTTTGGTTTATTTTTCTAGTTTATCTAAGATCGGTTATGTGGTAACACCTTTTTATTTTGTCGGAGGTGTTPTGTCTGTATTTTTTTTTTACCCTTT 397 V I L V Y F S S L S K I G Y V V T P F Y F V G G V L S V F F F Y P F I I I I I I I I I I I I I I I I I I I I I I I 1 1 1 I I I I I l l I I I I I I I I I I I 1 I I I I I I I I I I I V L T Y S S Y L G L S G F Y Y S I Y W F I F C F I L V C L L F F M C . e AGTATTAACTTATAGAAGATATTTAGGTTTAAGAGGTTTTTATTATAGTATTTACTGGTTTATT~TGTTTTATTTTAGTATGTTTATTATTTTTTATA 496 I I I I I I I I I I I I I I I I I I I I I I I I I I I l l I I I I I I I I I l l 1 I I I I I I I I I I A . 9 TTTTTATAGGGTAACTGATGTTGTTGCTGTTAATAA~TTTATTTTAGTGTTTATTGGATGTTGTTGGTCTGGGTGATTTTTGTTTTAATTTTTTTTATA 497 F Y S V T D V V A V N N F Y F S V Y W M L L V W V I F V L I F F M ND4L N F S S Y F L N F S G A L R K V t e r I M F L F V S L F M F I F K W Q C.e AATTTTAGTAGTTATTTTPTAAATTTTTCAGGTGCTTTTACGTAAAGTTTAA-AATTATGTTTTTATTTGTTAGATTATTTATATTTATTTTTAAATGACA 595 A . 9 AATTTCACAAGTTATTTTTTAAACTTTTCGGGGGCTTTGCGAAAAGTTTAGTAATTATTTTTTATTTTTATTAGATTTTTGTCATTGTTTTTTAAGTGGCA 597 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I l l I I l l I I I I I I I I 1 I l l I O I I I I I I I I N F T S Y F L N F S G A L R K V t e r I I F I F I S F L S L F F K W Q ND4L R L I F I L I S L E F M M L S L F L K F S Y V L G E M M F F Y F M C . e ACGTTTAATTTTTATTCTAATTTCTTTAGAATTTATAATGTTGAGATTATTTTTAAAATTTTCTTATGTTTTAGGGGAAATAATGTTT~TATTTTATG 695 A . 9 ACGTTTGATGTTTATTTTGATTTCATTGGAGTTTATTGTGATAAGGTTATTTATTTTATTTTCGGGTGATTTGAATGAAATGATGTTTTTTTATTTTATG 697 I I I I I I I I I I I O I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I l l I I I I I I I I I I I I I I I I I I I I I I I R L M F I L I S L E F I V M S L F I L F S G D L N E M M F F Y F M C F S 'V I S k I L G' M V V 'M V G N M K F. F G S D N C F ter ;--tRNA(trp) C . e TGTTTTTCTGTTATTTCAAGAATCCTGGGTATGGTAGTTATAGTAGGTAATATAAAATTTTTTGGTAGTGATAATTGTATTTTTTAGTAACAGATATAAG 795 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I l l I I I I I I I I l l I I I l l I l l I I I I I I I I I I O I I l l 1 A . s TGTTTTAGTGTTGTTTCTAGTGTTTTAGGTATGGTTGTTATAGTTGGAAATGTTAAGTTTTATGGAAGAGATTTGTGTTTATTTTAG--ACAGATTTAAG 795 C F S V V S S V L G M V V M V G N V K F Y G S D L C L F t e r \--tRNA(tTp) ---------------------< 2"-------------------\/--tRNA(glu)---------------------~ >""""""""C . e TTAAGTTTAAACTATTGATCTTCAAAATCAAAAATTTA~TCTGTAGAGATAATAGTATAAATAA---GTATGTTTCTTTTTCGCAGAAATGGTTTTTTA 892 A . 9 TTAAGTTTAAACTCTTGGTTTTCAAAACCAAAAATTTTACTCTGTAGAGATATTAGTATAAATTTTTTGTATATTTCTTTTTCGAAGAAAAGGTTTATTA 895 I I I I I I I I I I I I I I l l I I I I I I I I I I I I I I I I I 1 1 1 1 1 1 1 1 1 1 1 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I l l ---------------------< >"-------------------/\--tRNA(glu)---------------------~ 2""""""""_"_ \ I =-rRNA _-____----I_ C . e TCTTA-TAAAGTTTT-CTTTCAGGGAATTAAAATTTGATCATGGTTTAAGATGAT-TTAAAATGGTATTATCTAAATTTGATTTACAGAGTAGGCAATAA 989 A . 9 TCTTATTTAAGTTTTACTTATAAGGATTTAAAATTTGATTATGGTTTTAGGTAGTGTTATAATGATGTTATCTGTTTTGGATTCATTGAATGGGCAATAA 995 I I I I I I I I I I I I I I l l I I l l 1 1 1 1 l I I I I l I I I I I I I I I I I I I I l l I l l 1 I I I I I I I I I I I I I I I 1 I I I I I I I I I _"_ / I =-rRNA -----------C . e AAATTTACCTCGGCAATTTATCGCTTGTAAAATACTTGTTCCAGAATAATCGGCTAGACTTGTTAAAGCTTGTACTTTAATTGATGTTAATTATGAAATT 1089 A . 9 TTTTTTACCCTGGCATTTTGTCGTTTGTATAAATTTTGTTCCAGAATAATCGGCTAGACTTTATAAA-CTTGAACTCTAATTGATG~AGTTTAGGGTTT 1094 I I I I I I I I I I I l l I l l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I l l 1 I I I I I l l I I I I I I I I I I I I I I I I 1 C.e ATTATATTTTCTTTTAGATCTATGGTAGAATTTGGATTTATATTAGTGAATTTTCATAATTTTAAGATTTGTTGAACAAAGCAGATTAGTACCTGGTTAG 1189 A . 9 TGTAAATATATCTTGTTTTTAGGGTGAAATCGGG~TTTTTATTGATAATGCTCTAATCTTTAAGATTTGGTGAATGAATCAGATTAGTACCTGATTAA 1194 c . e ACAAAAATTAAAAGAGCAGGAGTAAAGT~;TATTTAAACTGAAAAGATATTGGCAGACATTCTAAATTATCTTTGGAGGCTGAGTAGTAACTGAGAACC~ 12 89 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I l l I l l I l l I I I I I I l l I I I I I I I I I I I I I I I l l 1 I I I I I I I I I I I I I I I I I l l A . s ACAAAAATTAAAAGAGCAGGAGTAAAGTTGTATTTATTTAAACTGTAAGAATATTGGCAGGT-TTTTAAATTATCTTTGGAGGTTGAGTAGTAATTGAGAACCC 1293 C.e TCATTAACTACTTAATTTTTGACTCGTGTATGATCGTTTATTTTATTCTTAAGGATTATAAT----AAAAAATTTTTAATTTATTAAAATAGATATATA 1385 A . S TCATTAACAACTTTTACTGTAGGCGCATGTATGATCGTTTATTTTATTCTTAAGGATTGTAATTTTAGATTAATTTATTTTCTGTAAAAATAGATAAATA 1393 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I l l c . e CCCGGTTTATGATTTAAGAAAC-ATTTGGCCTACAATATTTTATATTATGGATTTTAGTTTTAGTTAACTAAATGAAATTGTAAAAGACAGTAAAAAATT 1484 I I l l I l l 1 I I I I I I I I I I I I I I I I I I I l l I I I I I I I I I I I I I I I I I I I I I l I l l I I l I I 1 1 1 l 1 1 I I A . S CTTGGTGTATG-TAAAAGATTTAATTTGACCTACAATATGCTATCTTGTGGATACTT-TTTTAGTAGA-AGGTTGAAAATGTAAAAGACAGTAAGTTTTT 1490 C . e CTTAATGTATTTTTGAAGATTATCTAGAAGTGGTACAAATCATCCATCAATTGCCCAAAGGGGAGTAAGTTGTAGTAAAGTAGATTTAGGGGAACCTGAA 1584 A . 9 TTTTATATAAAGCTGAAGTTTATTTAAAAACGGTACAAATCATCCATCAATTGCCTTCAGGGGAGTAAGTTGTAGTAAAGTAGAGTTAGGGGAACCTGGC 1590 """""_ I I I I I I I I I I I I I I I I1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I J I I I I I 1 1 1 1 l 1 1 l 1 l